D661Y |
Detail variant |
Location in the gene |
exon 10 |
Usual name
Name as first published or submitted to Infevers.
May be different from the HGVS edited protein and sequence names.
|
D661Y |
HGVS protein name |
p.(Asp661Tyr) |
HGVS sequence name |
c.1981G>T |
rs Number |
- |
Sequence |
cDNA: GAGGTGGAGGTTGGAGACAAGACAGCATGGA |
Alteration |
Substitution |
N base(s)
|
1
|
Base substituded
|
G>T |
Pathogenicity score/Status
If you have new data: please send us a re-evaluation proposal here |
Not classified
|
Population Frequencies
GnomAD v2.1.1 via Annovar |
See data
Hide data
|
African |
Ashkenazi Jewish |
East Asian |
European (Finnish) |
European (non-Finnish) |
Latino |
South Asian |
Other |
Total |
Exome |
. |
. |
. |
. |
. |
. |
. |
. |
. |
Genome |
. |
. |
. |
. |
. |
. |
. |
. |
. |
|
Using In silico prediction? |
Unknown
|
Functional tests |
No |
Functional approach |
Not applicable
|
Consequence |
Unknown |
Technique(s) used |
Sequencing Sanger |
Phenotype
a variant observed in symptomatic subjects does not imply its causal role |
Disease related symptoms in this patient |
Symptomatic |
Associated phenotype in this patient
|
PAAD-FMF (with criteria) |
Country of origin / Ancestry |
Iran, islamic republic of / Asian |
Contribution |
Reference |
Hosseini-Asl,SS; Salehzadeh,F; Mohammadi-Kebar,Y Personal communication |
Contributed by |
S Saied HOSSEINI-ASL
|
Comment |
- |
Input date |
2018-12-14 |